ID: 920386103_920386114

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 920386103 920386114
Species Human (GRCh38) Human (GRCh38)
Location 1:205570947-205570969 1:205570993-205571015
Sequence CCACCCAGCTGGGCCATCTCTTC AGCACTGCTTACCCAACAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 327} {0: 1, 1: 0, 2: 2, 3: 6, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!