ID: 920389017_920389024

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 920389017 920389024
Species Human (GRCh38) Human (GRCh38)
Location 1:205587276-205587298 1:205587326-205587348
Sequence CCAAGTAGCCCAATGAGGGTACT GTTGAATTTCTAGCAGAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44} {0: 1, 1: 1, 2: 2, 3: 280, 4: 13092}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!