ID: 920390199_920390202

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 920390199 920390202
Species Human (GRCh38) Human (GRCh38)
Location 1:205595295-205595317 1:205595309-205595331
Sequence CCTCCCTACTTTGGCACGTGGTG CACGTGGTGAACCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 77} {0: 1, 1: 0, 2: 4, 3: 26, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!