ID: 920397818_920397824

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 920397818 920397824
Species Human (GRCh38) Human (GRCh38)
Location 1:205659557-205659579 1:205659581-205659603
Sequence CCACGTGTCCATTAGGGAAGGGA CTCCAGGCTTAGGGCCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95} {0: 1, 1: 0, 2: 2, 3: 26, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!