ID: 920399498_920399504

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 920399498 920399504
Species Human (GRCh38) Human (GRCh38)
Location 1:205668316-205668338 1:205668331-205668353
Sequence CCGCTCCAGGGCCGCCTTCCCTG CTTCCCTGGAGCACAAACGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 549} {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!