ID: 920399498_920399513

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 920399498 920399513
Species Human (GRCh38) Human (GRCh38)
Location 1:205668316-205668338 1:205668366-205668388
Sequence CCGCTCCAGGGCCGCCTTCCCTG CTCAGTTGTCAGGCTCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 549} {0: 1, 1: 0, 2: 2, 3: 17, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!