ID: 920409658_920409668

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 920409658 920409668
Species Human (GRCh38) Human (GRCh38)
Location 1:205749608-205749630 1:205749648-205749670
Sequence CCGAGGAGGTGGGGCCTCTTGGG CCTCCCCCTCCGGCCGCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 293} {0: 1, 1: 0, 2: 1, 3: 28, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!