ID: 920416006_920416012

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 920416006 920416012
Species Human (GRCh38) Human (GRCh38)
Location 1:205799792-205799814 1:205799818-205799840
Sequence CCAGAGCTCCTTGGGTGTGTCCA GTCCAATGTTGGCCTGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 186} {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!