ID: 920416007_920416012

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 920416007 920416012
Species Human (GRCh38) Human (GRCh38)
Location 1:205799800-205799822 1:205799818-205799840
Sequence CCTTGGGTGTGTCCATGTGTCCA GTCCAATGTTGGCCTGGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 1282} {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!