ID: 920441985_920441993

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 920441985 920441993
Species Human (GRCh38) Human (GRCh38)
Location 1:205986845-205986867 1:205986898-205986920
Sequence CCAGAACACAGTGCAGGCCGAGG TCTGTGGCTCCTGCAGGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125} {0: 1, 1: 0, 2: 9, 3: 54, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!