ID: 920472192_920472196

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 920472192 920472196
Species Human (GRCh38) Human (GRCh38)
Location 1:206240819-206240841 1:206240859-206240881
Sequence CCATAGGGCTGCTGAACCTGACC ATGTTACTTCTTCCATTCCTTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 5, 4: 112} {0: 4, 1: 0, 2: 4, 3: 21, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!