ID: 920503080_920503087

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 920503080 920503087
Species Human (GRCh38) Human (GRCh38)
Location 1:206497640-206497662 1:206497671-206497693
Sequence CCTCTGTGGTGCTTCTCTGTGCA CACTCTAAAGGCCTGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 357} {0: 1, 1: 0, 2: 2, 3: 23, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!