ID: 920507473_920507488

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 920507473 920507488
Species Human (GRCh38) Human (GRCh38)
Location 1:206526652-206526674 1:206526690-206526712
Sequence CCTATCCTTCCAGCCCCCCTGCC CATTAAAGGCAGAAGTTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 954} {0: 1, 1: 1, 2: 0, 3: 28, 4: 442}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!