|
Left Crispr |
Right Crispr |
| Crispr ID |
920510402 |
920510403 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:206547315-206547337
|
1:206547328-206547350
|
| Sequence |
CCACGCTTCATCTGTATTTACAG |
GTATTTACAGCCACTCCCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 10, 2: 18, 3: 16, 4: 112} |
{0: 21, 1: 21, 2: 64, 3: 49, 4: 181} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|