ID: 920512317_920512328

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 920512317 920512328
Species Human (GRCh38) Human (GRCh38)
Location 1:206560345-206560367 1:206560382-206560404
Sequence CCAATGCCCTTTGGGAAGAGGTC GGTCTCCCCATTTCATAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 148} {0: 1, 1: 0, 2: 2, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!