ID: 920513794_920513803

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 920513794 920513803
Species Human (GRCh38) Human (GRCh38)
Location 1:206569288-206569310 1:206569324-206569346
Sequence CCCAAATAGGTTATGGTTGGTAA GGCAACACAGGTTTTGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 108} {0: 1, 1: 2, 2: 15, 3: 62, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!