ID: 920516301_920516306

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 920516301 920516306
Species Human (GRCh38) Human (GRCh38)
Location 1:206586897-206586919 1:206586942-206586964
Sequence CCAACAAGTGCAAAAGAAGTATG GGAGGCCTTAAGAGAATCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 196} {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!