ID: 920533701_920533707

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 920533701 920533707
Species Human (GRCh38) Human (GRCh38)
Location 1:206723557-206723579 1:206723585-206723607
Sequence CCTTCCCAGTCTTGTCTTCATGT TTGCTGACGAGTGGCACATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 290} {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!