ID: 920535489_920535505

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 920535489 920535505
Species Human (GRCh38) Human (GRCh38)
Location 1:206734066-206734088 1:206734113-206734135
Sequence CCTTCCCTTGGAGGGAGAGGTGG CCTCAGGGGCAGGTGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 331} {0: 1, 1: 0, 2: 4, 3: 57, 4: 492}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!