ID: 920557235_920557244

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 920557235 920557244
Species Human (GRCh38) Human (GRCh38)
Location 1:206913120-206913142 1:206913162-206913184
Sequence CCAAAGTGGATGACAGTGAGGGG AAAGAAGCAGAGAAGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 350} {0: 1, 1: 0, 2: 5, 3: 99, 4: 1180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!