|
Left Crispr |
Right Crispr |
| Crispr ID |
920580203 |
920580207 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:207099368-207099390
|
1:207099397-207099419
|
| Sequence |
CCTGCCCGCTGCTCACTTTCTGC |
GCCCAGTTCCTAATAGTCCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 10, 3: 61, 4: 324} |
{0: 1, 1: 2, 2: 35, 3: 352, 4: 647} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|