ID: 920612449_920612461

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 920612449 920612461
Species Human (GRCh38) Human (GRCh38)
Location 1:207454664-207454686 1:207454710-207454732
Sequence CCGGGAGCTGGGACCTCCAGAAT GCTGTCTGGTCGGCCCGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 259} {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!