ID: 920624146_920624149

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 920624146 920624149
Species Human (GRCh38) Human (GRCh38)
Location 1:207579625-207579647 1:207579650-207579672
Sequence CCTCAATCTGCATTGATCCACTC TAATTTACATGTAACTGAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 47, 4: 484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!