ID: 920625830_920625835

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 920625830 920625835
Species Human (GRCh38) Human (GRCh38)
Location 1:207597802-207597824 1:207597847-207597869
Sequence CCGTAGCAGCTTTGTTCAAAATA AGTATCTACGAGCAGATGAATGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 21, 3: 142, 4: 628} {0: 1, 1: 0, 2: 14, 3: 80, 4: 705}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!