|
Left Crispr |
Right Crispr |
| Crispr ID |
920636741 |
920636750 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:207711584-207711606
|
1:207711617-207711639
|
| Sequence |
CCTCAATTTGCATTGATGTGCCC |
CTGTAATTGGCTGGGCATGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 7, 3: 27, 4: 120} |
{0: 2, 1: 7, 2: 161, 3: 2306, 4: 32143} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|