ID: 920682592_920682598

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 920682592 920682598
Species Human (GRCh38) Human (GRCh38)
Location 1:208084253-208084275 1:208084280-208084302
Sequence CCTGGGGATGTGGGCTCAGCCTG CCTGGAAGGCTCCGGAAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 366} {0: 1, 1: 0, 2: 1, 3: 22, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!