ID: 920779651_920779655

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 920779651 920779655
Species Human (GRCh38) Human (GRCh38)
Location 1:208976243-208976265 1:208976268-208976290
Sequence CCTGACACACCTTCCATTAAGAG AGGATCTATGTCCTCTTCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 14, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!