ID: 920795284_920795288

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 920795284 920795288
Species Human (GRCh38) Human (GRCh38)
Location 1:209131047-209131069 1:209131074-209131096
Sequence CCCAAGGAAACCTGGAAAACTAG CTAGTTCACACTATGCCGACGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 79, 3: 290, 4: 637} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!