ID: 920851589_920851593

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 920851589 920851593
Species Human (GRCh38) Human (GRCh38)
Location 1:209631771-209631793 1:209631786-209631808
Sequence CCTGAGCTGGCCTCCCTCTGTAC CTCTGTACACCTCTGCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 225} {0: 1, 1: 0, 2: 3, 3: 24, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!