ID: 920857636_920857644

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 920857636 920857644
Species Human (GRCh38) Human (GRCh38)
Location 1:209675786-209675808 1:209675834-209675856
Sequence CCTCTTCGGCGTGGTGCTCGGCC CACGGCCGCCAGACGTCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 49} {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!