|
Left Crispr |
Right Crispr |
| Crispr ID |
920867529 |
920867536 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:209765491-209765513
|
1:209765543-209765565
|
| Sequence |
CCTCGTCTCTACTAAAAATACAA |
TGTAGTCTTAGGAACTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 98173, 1: 216399, 2: 153384, 3: 81062, 4: 60801} |
{0: 1, 1: 5, 2: 389, 3: 7460, 4: 68198} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|