|
Left Crispr |
Right Crispr |
Crispr ID |
920867532 |
920867536 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:209765522-209765544
|
1:209765543-209765565
|
Sequence |
CCAGGTACATTGGCATGCACCTG |
TGTAGTCTTAGGAACTCAGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 14, 2: 184, 3: 1343, 4: 9266} |
{0: 1, 1: 5, 2: 389, 3: 7460, 4: 68198} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|