ID: 920894670_920894673

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 920894670 920894673
Species Human (GRCh38) Human (GRCh38)
Location 1:210034643-210034665 1:210034694-210034716
Sequence CCAATTTCTATGTTCAGTTTCTA CCTAGCTTCCACTTAAAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 465} {0: 1, 1: 0, 2: 1, 3: 36, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!