ID: 920924870_920924872

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 920924870 920924872
Species Human (GRCh38) Human (GRCh38)
Location 1:210331303-210331325 1:210331342-210331364
Sequence CCTACTTCATAGTCTCATTTTGG AGACCCTGCTTCACAAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 283} {0: 2, 1: 20, 2: 31, 3: 43, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!