|
Left Crispr |
Right Crispr |
| Crispr ID |
920930438 |
920930446 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:210382935-210382957
|
1:210382988-210383010
|
| Sequence |
CCCGGCTCTGCCCCTTACTAGGT |
CAGTTAACTCATTTGTAACACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 80, 3: 533, 4: 2027} |
{0: 1, 1: 1, 2: 30, 3: 428, 4: 3346} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|