ID: 920932935_920932943

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 920932935 920932943
Species Human (GRCh38) Human (GRCh38)
Location 1:210406029-210406051 1:210406058-210406080
Sequence CCTCCTGAATCACAGCCTCTAGG GCCCAGGAAGGTGGTTTAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 303} {0: 1, 1: 0, 2: 1, 3: 16, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!