ID: 920936602_920936604

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 920936602 920936604
Species Human (GRCh38) Human (GRCh38)
Location 1:210440680-210440702 1:210440710-210440732
Sequence CCAGGTGACTCCAGACAGTAATT CAATTTCAACACTGTGTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 16, 3: 67, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!