ID: 920938677_920938682

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920938677 920938682
Species Human (GRCh38) Human (GRCh38)
Location 1:210459920-210459942 1:210459933-210459955
Sequence CCAGGGTTGCCATCTTTCAAAGG CTTTCAAAGGTGTAACTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117} {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!