ID: 920943002_920943011

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 920943002 920943011
Species Human (GRCh38) Human (GRCh38)
Location 1:210501598-210501620 1:210501636-210501658
Sequence CCATGTCTGCAATCTGCTGACGT CAGCTGCTCCTGGGGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 87} {0: 1, 1: 0, 2: 4, 3: 38, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!