ID: 920953768_920953775

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 920953768 920953775
Species Human (GRCh38) Human (GRCh38)
Location 1:210598630-210598652 1:210598672-210598694
Sequence CCCACAGTCACTGTGATCTTTCT TCACTCCCCGTGGCTGCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 61, 4: 337} {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!