ID: 920953768_920953781

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 920953768 920953781
Species Human (GRCh38) Human (GRCh38)
Location 1:210598630-210598652 1:210598682-210598704
Sequence CCCACAGTCACTGTGATCTTTCT TGGCTGCTGTTGGAGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 61, 4: 337} {0: 1, 1: 1, 2: 9, 3: 80, 4: 757}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!