|
Left Crispr |
Right Crispr |
| Crispr ID |
920999403 |
920999407 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:211027326-211027348
|
1:211027356-211027378
|
| Sequence |
CCAGGCTCAGTGGCTCATGTCTC |
AACATTTTGGAGGCCAATGTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 43, 2: 1568, 3: 20401, 4: 69477} |
{0: 1, 1: 1, 2: 53, 3: 471, 4: 2251} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|