|
Left Crispr |
Right Crispr |
| Crispr ID |
921106595 |
921106598 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:211987012-211987034
|
1:211987038-211987060
|
| Sequence |
CCAGCCTGGGCACAGTGGCTCAT |
TGTAACCCCAGCACTTTGAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 244, 2: 1348, 3: 3812, 4: 8056} |
{0: 14, 1: 1065, 2: 26961, 3: 324180, 4: 259913} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|