|
Left Crispr |
Right Crispr |
| Crispr ID |
921106595 |
921106602 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:211987012-211987034
|
1:211987044-211987066
|
| Sequence |
CCAGCCTGGGCACAGTGGCTCAT |
CCCAGCACTTTGAAAGGGCAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 244, 2: 1348, 3: 3812, 4: 8056} |
{0: 6, 1: 274, 2: 8003, 3: 102087, 4: 223477} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|