|
Left Crispr |
Right Crispr |
| Crispr ID |
921106596 |
921106599 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:211987016-211987038
|
1:211987039-211987061
|
| Sequence |
CCTGGGCACAGTGGCTCATGCCT |
GTAACCCCAGCACTTTGAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 139, 1: 602, 2: 1606, 3: 2877, 4: 4170} |
{0: 1, 1: 20, 2: 339, 3: 2962, 4: 3884} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|