|
Left Crispr |
Right Crispr |
Crispr ID |
921106597 |
921106607 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:211987036-211987058
|
1:211987062-211987084
|
Sequence |
CCTGTAACCCCAGCACTTTGAAA |
CAAGGTGGGTGGATCACTTGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 1021, 2: 26569, 3: 321206, 4: 259823} |
{0: 2569, 1: 14350, 2: 40057, 3: 73907, 4: 94464} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|