ID: 921111077_921111083

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 921111077 921111083
Species Human (GRCh38) Human (GRCh38)
Location 1:212037344-212037366 1:212037380-212037402
Sequence CCTCTTCAGTGTTGGTGTTCCAT TCTTCTTCTACCTACTCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 168} {0: 1, 1: 0, 2: 4, 3: 28, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!