|
Left Crispr |
Right Crispr |
| Crispr ID |
921151863 |
921151871 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:212409139-212409161
|
1:212409178-212409200
|
| Sequence |
CCAACCTCCATCTGTGGAAAAAT |
GTCCCTGGTGCCAAAAAGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 17, 2: 68, 3: 210, 4: 676} |
{0: 113, 1: 1184, 2: 1829, 3: 1368, 4: 871} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|