ID: 921163330_921163338

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 921163330 921163338
Species Human (GRCh38) Human (GRCh38)
Location 1:212488132-212488154 1:212488176-212488198
Sequence CCTCTCCTGTAAGGTCATGGAGG CCCCCGTCCTGGCCCTCCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!