ID: 921196195_921196198

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 921196195 921196198
Species Human (GRCh38) Human (GRCh38)
Location 1:212760183-212760205 1:212760201-212760223
Sequence CCAGCCTGTGGGCCACTGGTACC GTACCTGAGCACACTAACCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 141} {0: 1, 1: 0, 2: 2, 3: 10, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!